SP6 RNA Polymerase
SP6 RNA Polymerase is a HIGHLY SPECIFIC DNA-dependent 5' →3' RNA polymerase that recognizes SP6 promoter sequences. SP6 RNA polymerase can catalyze the incorporation of NTP downstream of single- or double-stranded DNA SP6 promoters to synthesize RNA that is complementary to the template DNA downstream of the SP6 promoter. The SP6 promoter sequence is ATTTAGGTGACACTATAGAA, where the last G is the first base of transcription.
The RNA synthesized by SP6 RNA Polymerase can be used for hybridization probes, genomic DNA sequence analysis, RNase protection assays, antisense RNA synthesis, RNA templates for in vitro translation, substrates for RNA splicing studies, RNA secondary structure and RNA-protein interactions, nucleic acid amplification analysis, siRNA, miRNA and other small RNAs.
| Components | 2000 U | 5000 U | 10000 U |
| SP6 RNA Polymerase (20U/μl) | 0.1 ml | 0.25 ml | 0.5 ml |
| 10X SP6 Reaction Buffer | 0.2 ml | 0.5 ml | 1 ml |
Store at -20 °C. | |||














