Setting 
My Cart
Toggle Nav
Close
  • Menu
  • Setting

SP6 RNA Polymerase

Catalog No.
K1096
SP6 RNA Polymerase, highly specific identification of SP6 promoter sequences
Grouped product items
SizePriceStock Qty
2000U
$55.00
In stock
5000U
$70.00
In stock
10000U
$110.00
In stock
For scientific research use only and should not be used for diagnostic or medical purposes.

Tel: +1-832-696-8203

Email: [email protected]

Worldwide Distributors

Description

SP6 RNA Polymerase is a HIGHLY SPECIFIC DNA-dependent 5' →3' RNA polymerase that recognizes SP6 promoter sequences. SP6 RNA polymerase can catalyze the incorporation of NTP downstream of single- or double-stranded DNA SP6 promoters to synthesize RNA that is complementary to the template DNA downstream of the SP6 promoter. The SP6 promoter sequence is ATTTAGGTGACACTATAGAA, where the last G is the first base of transcription.

The RNA synthesized by SP6 RNA Polymerase can be used for hybridization probes, genomic DNA sequence analysis, RNase protection assays, antisense RNA synthesis, RNA templates for in vitro translation, substrates for RNA splicing studies, RNA secondary structure and RNA-protein interactions, nucleic acid amplification analysis, siRNA, miRNA and other small RNAs.

Quality Control

Quality Control & DataSheet

View current batch:
 

User Guide

Components and Storage

Components 2000 U 5000 U 10000 U
SP6 RNA Polymerase (20U/μl) 0.1 ml 0.25 ml 0.5 ml
10X SP6 Reaction Buffer 0.2 ml 0.5 ml 1 ml

Store at -20 °C.