Bepirovirsen sodium

Bepirovirsen sodium（CAS No.：2563929-84-8） is the sodium salt form of Bepirovirsen。Bepirovirsen（GSK3228836，CAS No.：1403787-62-1） is a 20-mer single-stranded phosphorothioate-modified antisense oligonucleotide with a 5-10-5 Gapmer（RNA-DNA-RNA，2'-MOE-modified） structure and the sequence GCACTTCGCTTCACCTCTGC。It can specifically bind homologous target sequences on all HBV mRNAs and pregenomic RNA through Watson-Crick base pairing；it acts primarily through two pathways：the first is a canonical antiviral pathway，in which binding to target RNA leads to sequence-specific degradation mediated by endogenous RNase H，reducing intracellular levels of HBV-derived RNA、DNA and viral proteins；the second is an innate immune activation pathway，in which it has weak，species-specific agonistic activity toward human TLR8（hTLR8），activates downstream pathways including NF-κB，induces the secretion of cytokines including IFN-γ、TNF-α、IL-6、IL-12p40 and chemokines including CCL2、CCL4、CXCL10，and recruits and activates immune cells including monocytes、dendritic cells、NK cells，producing combined immunomodulatory and antiviral effects。

At the cellular level，it can induce weak but significant receptor activation in HEK cells overexpressing hTLR8（p=0.0085），suggesting a direct immunomodulatory effect on hTLR8。Human peripheral blood mononuclear cells（PBMC） are commonly used in in vitro exposure experiments，which have shown dose-dependent induction of multiple proinflammatory cytokines；target-specific validation is performed by overexpressing hTLR8 in HEK or THP-1 cell lines；HBV replication cell models are also used to evaluate its RNase H-mediated antiviral effects，including downward trends in HBV RNA、HBsAg/HBeAg and viral DNA levels。

In animal experiments，tissue distribution studies in CByB6F1 mice given 4–40 mg/kg subcutaneously showed that approximately 87.1% of the drug in the liver was distributed in nonparenchymal cells（such as Kupffer cells、liver sinusoidal endothelial cells，etc.），while only approximately 12.9% was distributed in hepatocytes；in the kidney，it was mainly enriched in the proximal renal tubules，helping to clarify its targeting of the hepatic immune microenvironment。Immune mechanism studies used hTLR8 transgenic mice；subcutaneous administration of 40 mg/kg significantly increased levels of multiple proinflammatory cytokines in the liver and plasma，whereas no clear difference in immune activation was observed in wild-type mice。Together，these two sets of animal data support its human TLR8-dependent immune activation characteristics and pharmacological mechanism。

At the clinical level，in a Phase IIa trial，it was administered subcutaneously on days 1、4、8、11、15、22 at doses of 150 mg and 300 mg，and rapidly and persistently reduced serum HBsAg levels in patients over a relatively short period。Responders often also had elevated ALT and upregulation of multiple innate immunity-related cytokines，suggesting a mechanism involving both antiviral effects and immune activation。It may be used as monotherapy or in combination with nucleoside（nucleotide） analogues，providing a new antisense oligonucleotide drug candidate for strategies aimed at a functional cure for chronic HBV。

References：

[1] Soriano V, Moreno-Torres V, Treviño A, Corral O, de Mendoza C. Bulevirtide in the Treatment of Hepatitis Delta: Drug Discovery, Clinical Development and Place in Therapy. Drug Des Devel Ther. 2023 Jan 21;17:155-166. doi: 10.2147/DDDT.S379964. PMID: 36712949; PMCID: PMC9875571.

[2] Spencer-Dene B, Mukherjee P, Alex A, Bera K, Tseng WJ, Shi J, Chaney EJ, Spillman DR Jr, Marjanovic M, Miranda E, Boppart SA, Hood SR. Localization of unlabeled bepirovirsen antisense oligonucleotide in murine tissues using in situ hybridization and CARS imaging. RNA. 2023 Oct;29(10):1575-1590. doi: 10.1261/rna.079699.123. Epub 2023 Jul 17. PMID: 37460153; PMCID: PMC10578491.

[3] Ermler ME, Delahaye JL, Jordan W, Nivarthi U, DeHart A, Jones K, Das A, Galwey N, Hoang B, Terry RL, Tarrant J, Sherina V, Ray A, Austin D, Singh JM, Theodore D, Paff M, You S. Bepirovirsen induces innate immune activation in the liver potentially through TLR8 signaling. JHEP Rep. 2026 Sep;8(9):101923. doi: 10.1016/j.jhepr.2026.101923. Epub 2026 Jun 9. PMID: 42264034; PMCID: PMC13482607.