Bepirovirsen
Catalog No.
BA1821
Bepirovirsen is an antisense oligonucleotide that targets all messenger RNAs.
Featured Products
Bepirovirsen is an antisense oligonucleotide that targets all messenger RNAs.Bepirovirsen results in a reduction of source RNAs, HBVDNA, and viral proteins.Bepirovirsen can be used in chronic infection studies.Bepirovirsen binding site sequence ( GCACTTCGCTTCACCTCTGC).
| Physical Appearance | A solid |
| Storage | Tightly sealed and desiccated at -20°C |
| M.Wt | 7344.00 |
| Cas No. | 1403787-62-1 |
| Synonyms | ISIS505358 |
| Shipping Condition | Small Molecules with Blue Ice, Modified Nucleotides with Dry Ice. |
| General tips | We do not recommend long-term storage for the solution, please use it up soon. |