Bepirovirsen

Bepirovirsen（GSK3228836，CAS No.：1403787-62-1） is a 20-mer single-stranded phosphorothioate-modified antisense oligonucleotide with a 5-10-5 Gapmer（RNA-DNA-RNA，2'-MOE-modified） structure and the sequence GCACTTCGCTTCACCTCTGC，and can specifically bind homologous target sequences on all HBV mRNAs and pregenomic RNA through Watson-Crick base pairing；it acts primarily through two pathways：first，the canonical antiviral pathway，in which binding to target RNA is followed by sequence-specific degradation mediated by endogenous RNase H，reducing intracellular levels of HBV-derived RNA、DNA and viral proteins；second，the innate immune activation pathway，in which it has weak，species-specific agonist activity toward human TLR8（hTLR8），activates downstream pathways such as NF-κB，induces the secretion of cytokines including IFN-γ、TNF-α、IL-6 and IL-12p40 and chemokines including CCL2、CCL4 and CXCL10，and recruits and activates immune cells such as monocytes、dendritic cells and NK cells，jointly producing immunomodulatory and antiviral effects。

At the cellular level，it can induce weak but significant receptor activation in HEK cells overexpressing hTLR8（p=0.0085），suggesting a direct immunomodulatory effect on hTLR8。In vitro，human peripheral blood mononuclear cells（PBMC） are commonly used in exposure experiments，in which dose-dependent induction of various proinflammatory cytokines has been observed；target-specific validation is performed through hTLR8 overexpression in HEK or THP-1 cell lines；it is also used in HBV-replicating cell models to assess its RNase H-mediated antiviral activity，including trends toward reduced levels of HBV RNA、HBsAg/HBeAg and viral DNA。

In animal experiments，tissue distribution studies in CByB6F1 mice used subcutaneous doses of 4–40 mg/kg，and the results showed that approximately 87.1% of the drug in the liver was distributed in nonparenchymal cells（such as Kupffer cells、liver sinusoidal endothelial cells，etc.），with only approximately 12.9% distributed in hepatocytes，while in the kidney it was mainly concentrated in proximal tubules，helping to elucidate its targeting of the liver immune microenvironment；immunological mechanism studies used hTLR8 transgenic mice，in which subcutaneous administration of 40 mg/kg significantly increased the levels of various proinflammatory cytokines in the liver and plasma，whereas no appreciable difference in immune activation was observed in wild-type mice，and these two sets of animal data together support its human TLR8-dependent immune activation properties and pharmacological mechanism。

At the clinical level，Phase IIa clinical studies used subcutaneous administration，with dosing on days 1、4、8、11、15、22 at doses of 150 mg and 300 mg，which could rapidly and persistently reduce patients' serum HBsAg levels within a relatively short time，with responders often showing ALT elevations and upregulation of various innate immunity-related cytokines，suggesting a mechanism combining antiviral effects and immune activation，and it may be used as monotherapy or in combination with nucleos(t)ide analogues，providing a new antisense oligonucleotide drug candidate for functional cure strategies for chronic HBV。

References：

[1] Soriano V, Moreno-Torres V, Treviño A, Corral O, de Mendoza C. Bulevirtide in the Treatment of Hepatitis Delta: Drug Discovery, Clinical Development and Place in Therapy. Drug Des Devel Ther. 2023 Jan 21;17:155-166. doi: 10.2147/DDDT.S379964. PMID: 36712949; PMCID: PMC9875571.

[2] Spencer-Dene B, Mukherjee P, Alex A, Bera K, Tseng WJ, Shi J, Chaney EJ, Spillman DR Jr, Marjanovic M, Miranda E, Boppart SA, Hood SR. Localization of unlabeled bepirovirsen antisense oligonucleotide in murine tissues using in situ hybridization and CARS imaging. RNA. 2023 Oct;29(10):1575-1590. doi: 10.1261/rna.079699.123. Epub 2023 Jul 17. PMID: 37460153; PMCID: PMC10578491.

[3] Ermler ME, Delahaye JL, Jordan W, Nivarthi U, DeHart A, Jones K, Das A, Galwey N, Hoang B, Terry RL, Tarrant J, Sherina V, Ray A, Austin D, Singh JM, Theodore D, Paff M, You S. Bepirovirsen induces innate immune activation in the liver potentially through TLR8 signaling. JHEP Rep. 2026 Sep;8(9):101923. doi: 10.1016/j.jhepr.2026.101923. Epub 2026 Jun 9. PMID: 42264034; PMCID: PMC13482607.