SP6 RNA Polymerase
mRNA synthesis
In vitro transcription of capped mRNA with modified nucleotides and Poly(A) tail
Tyramide Signal Amplification (TSA)
TSA (Tyramide Signal Amplification), used for signal amplification of ISH, IHC and IC etc.
Phos Binding Reagent Acrylamide
Separation of phosphorylated and non-phosphorylated proteins without phospho-specific antibody
Cell Counting Kit-8 (CCK-8)
A convenient and sensitive way for cell proliferation assay and cytotoxicity assay
SYBR Safe DNA Gel Stain
Safe and sensitive stain for visualization of DNA or RNA in agarose or acrylamide gels.
Inhibitor Cocktails
Protect the integrity of proteins from multiple proteases and phosphatases for different applications.
SP6 RNA Polymerase is a HIGHLY SPECIFIC DNA-dependent 5' →3' RNA polymerase that recognizes SP6 promoter sequences. SP6 RNA polymerase can catalyze the incorporation of NTP downstream of single- or double-stranded DNA SP6 promoters to synthesize RNA that is complementary to the template DNA downstream of the SP6 promoter. The SP6 promoter sequence is ATTTAGGTGACACTATAGAA, where the last G is the first base of transcription.
The RNA synthesized by SP6 RNA Polymerase can be used for hybridization probes, genomic DNA sequence analysis, RNase protection assays, antisense RNA synthesis, RNA templates for in vitro translation, substrates for RNA splicing studies, RNA secondary structure and RNA-protein interactions, nucleic acid amplification analysis, siRNA, miRNA and other small RNAs.
| Components | 2000 U | 5000 U | 10000 U |
| SP6 RNA Polymerase (20U/μl) | 0.1 ml | 0.25 ml | 0.5 ml |
| 10X SP6 Reaction Buffer | 0.2 ml | 0.5 ml | 1 ml |
Store at -20 °C. | |||